
1H, 15N HSQC (imino) spectrum of 5_SL8loop: U-15N labeled RNA (25 mM potassium phosphate buffer pH 6.2, 50 mM KCl, 5% D2O) measured at 298K on a 700 MHz Spectrometer. Chemical shift assignment of Imino region is depicted and deposited in the BMRB doi:10.13018/BMR50349
Reference: Wacker, A., Weigand J.E. (2020) Nucleic Acids Res 48(22):12415-12435
Info:
31 nt, MW: 10.14 kD, OD260nm: 284.7 1/mM
Sequence:
GGAGUUGAAAAAGGCGUUUUGCCUCAACUCC