• Skip to primary navigation
  • Skip to main content
  • Skip to footer
COVID19-NMR

COVID19-NMR

  • About
    • Mission
    • Participation Guidelines
    • Data Management Plan
    • Research Targets
    • Timeline
  • News
  • Results
    • RNA Results
    • Protein Results
    • Screening Results
  • Publications
  • Participants
    • Core Team
    • Research Partners
    • Lab Members
    • Corporate Partners
    • Governance Board
  • Contact

RNA Results

Detailed results of 5_SL7sh

5_SL7sh

NMR Spectra recorded for 5_SL7sh:

  • 15N TROSY-HSQC

Preview & Download Data

Participants

1H, 15N HSQC (imino) spectrum of 5_SL7sh: 1.1 mM of U-13C,15N labeled RNA (25 mM potassium phosphate buffer pH 6.2, 50 mM KCl, 5% D2O) measured at 283K on a 800 MHz Spectrometer.

Info:

24 nt, MW: 7.98 kD

Sequence:
GGAGACUCCGUGGAGGAGGUCUUC

Want to be a part of it?

If you want to join the project, get in contact.

Funded by


Goethe Corona Fonds

Footer

Coordination

Prof. Dr. Harald Schwalbe (Coordinator)
Institut für Organische Chemie und Chemische Biologie
Zentrum für Biomolekulare Magnetische Resonanz

Johann Wolfgang Goethe-Universität
N160-3.13
Max-von-Laue-Strasse 7
D-60438 Frankfurt am Main

Contact us

++49 69 798 29737
schwalbe@nmr.uni-frankfurt.de

Twitter
 LOGS

Scientific Data Management powered by
Communication powered by
SIGNALS

Impress | Privacy Policy

This website uses cookies to improve your experience. We'll assume you're ok with this, but you can opt-out if you wish. Cookie settingsACCEPT
Privacy & Cookies Policy

Privacy Overview

This website uses cookies to improve your experience while you navigate through the website. Out of these cookies, the cookies that are categorized as necessary are stored on your browser as they are essential for the working of basic functionalities of the website. We also use third-party cookies that help us analyze and understand how you use this website. These cookies will be stored in your browser only with your consent. You also have the option to opt-out of these cookies. But opting out of some of these cookies may have an effect on your browsing experience.
Necessary
Always Enabled

Necessary cookies are absolutely essential for the website to function properly. This category only includes cookies that ensures basic functionalities and security features of the website. These cookies do not store any personal information.

Non-necessary

Any cookies that may not be particularly necessary for the website to function and is used specifically to collect user personal data via analytics, ads, other embedded contents are termed as non-necessary cookies. It is mandatory to procure user consent prior to running these cookies on your website.

SAVE & ACCEPT